You are using an unsupported browser. Please upgrade your browser to a newer version to get the best experience on Human Metabolome Database.
Showing Protein Solute carrier family 19 thiamine transporter member 2 (HMDBP10780)
Identification | |
---|---|
HMDB Protein ID | HMDBP10780 |
Secondary Accession Numbers |
|
Name | Solute carrier family 19 thiamine transporter member 2 |
Synonyms | Not Available |
Gene Name | SLC19A2 |
Protein Type | Unknown |
Biological Properties | |
General Function | Not Available |
Specific Function | Not Available |
Pathways | Not Available |
Reactions | Not Available |
GO Classification | Not Available |
Cellular Location | Not Available |
Gene Properties | |
Chromosome Location | Chromosome:1 |
Locus | 1q23.3 |
SNPs | SLC19A2 |
Gene Sequence |
>47 bp ATGGATGTGCCCGGCCCGGTGTCTCGGCGGGCGGCGGCGGCGGCGGC |
Protein Properties | |
Number of Residues | 16 |
Molecular Weight | 1539.7 |
Theoretical pI | 10.45 |
Pfam Domain Function | Not Available |
Signals |
|
Transmembrane Regions |
|
Protein Sequence |
>Solute carrier family 19 thiamine transporter member 2 MDVPGPVSRRAAAAAA |
External Links | |
GenBank ID Protein | 164370706 |
UniProtKB/Swiss-Prot ID | B0FBR7 |
UniProtKB/Swiss-Prot Entry Name | B0FBR7_HUMAN |
PDB IDs | Not Available |
GenBank Gene ID | EU302825 |
GeneCard ID | SLC19A2 |
GenAtlas ID | Not Available |
HGNC ID | Not Available |
References | |
General References |
|