Hmdb loader
Survey
You are using an unsupported browser. Please upgrade your browser to a newer version to get the best experience on Human Metabolome Database.
Identification
HMDB Protein ID HMDBP10814
Secondary Accession Numbers
  • 17091
Name Bradykinin B1 receptor
Synonyms Not Available
Gene Name Not Available
Protein Type Unknown
Biological Properties
General Function Involved in receptor activity
Specific Function Not Available
Pathways Not Available
Reactions Not Available
GO Classification Not Available
Cellular Location Not Available
Gene Properties
Chromosome Location Not Available
Locus Not Available
SNPs Not Available
Gene Sequence
>57 bp
GCTCCAATATCTTCATCCCATAGGAAAGAAATCTTCCAACTTTTCTGGCGGAATTAA
Protein Properties
Number of Residues 18
Molecular Weight 2216.5
Theoretical pI 11.48
Pfam Domain Function Not Available
Signals
  • None
Transmembrane Regions
  • None
Protein Sequence
>Bradykinin B1 receptor
APISSSHRKEIFQLFWRN
GenBank ID Protein Not Available
UniProtKB/Swiss-Prot ID Q71U72
UniProtKB/Swiss-Prot Entry Name Q71U72_HUMAN
PDB IDs Not Available
GenBank Gene ID AF117819
GeneCard ID Not Available
GenAtlas ID Not Available
HGNC ID Not Available
References
General References
  1. Zhou X, Prado GN, Chai M, Yang X, Taylor L, Polgar P: Posttranscriptional destabilization of the bradykinin B1 receptor messenger RNA: cloning and functional characterization of the 3'-untranslated region. Mol Cell Biol Res Commun. 1999 Apr;1(1):29-35. [PubMed:10329474 ]